Metagenomic of Secondary sludge

WAS was subjected to metagenomic sequencing isolated genomic DNA using a QIAamp PowerFecal Pro DNA kit' from a freeze-dried biomass pellet sample according to the manufacturer's recommendations (QIAGEN). The V4-V5 region of the 16S rRNA gene (universal primers V4: GTGCCAGCMGCCGCGGTAA, V5: CCGTCAATTCCTTTGAGTTT) was amplified by PCR following the standard workflow (Palanisamy et al., 2021). Sequence processing and cleaning was performed using Mothur v.1.47.0 (Kozich et al., 2013). After preprocessing, sequences were clustered into operational taxonomic units (OTUs) using the Silva gene reference database (version: 138.1) with a similarity threshold of 97% and aggregated to different phylogenetic levels. Prior to alpha diversity analysis, rarefaction was calculated with all sequences per sample. Microbial compositions were expressed as relative abundances